Date: 6 Jul 93 16:31:50 PDT (Tuesday)
Subject: Life A.1
----------------------------------------------------
The following are selections from rec.humor.funny
--------------------------
From: jonh@david.wheaton.edu (Jonathan Hayward)
It was slightly before Thanksgiving. The trip went reasonably well, and he was
ready to go back. The airport on the other end had turned a tacky red and
green, and loudspeakers blared annoying elevator renditions of cherished
Christmas carols.
Being someone who took Christmas very seriously, and being slightly tired, he
was not in a particularly good mood.
Going to check in his luggage (which, for some reason, had become one suitcase
with entirely new clothes), he saw hanging mistletoe. Not real mistletoe, but
very cheap plastic with red paint on some of the rounder parts and green paint
on some of the flatter and pointier parts, that could be taken for mistletoe
only in a very Picasso sort of way.
With a considerable degree of irritation and nowhere else to vent it, he said
to the attendant,
"Even if I were not married, I would not want to kiss you under such a ghastly
mockery of mistletoe."
"Sir, look more closely at where the mistletoe is."
(pause) "Ok, I see that it's above the luggage scale, which is the place you'd
have to step forward for a kiss."
"That's not why it's there."
(pause) "Ok, I give up. Why is it there?"
"It's there so you can kiss your luggage goodbye."
--------------------------
From: zorba@netcom.com (Harry Skelton)
[ True Story! ]
My son (age 6) is seriously into a set of superheros called X-Men. It seems
that one of the characters ("DeathLok") caught his interest the other day and
he wanted me to explain if the guy was a good guy or a bad guy.
"Well Son, he's a little of both.",I said. "He's a mercenary."
"What's a mercenary?", he asked.
"That's someone who will fight anyone if someone pays him enough.", I answered.
Then my daughter (age 9), trying to put it into perspective for my son said:
"What dad is saying is he's just like a lawyer."
--------------------------
From: frankdn@ei.dupont.com (Doug Frank)
From the March '93 "Yankee" magazine:
A prisoner at Boston's Deer Island House of Corrections
wrapped himself in a white sheet and climbed onto the
prison roof, refusing to come down until someone named
all six children on "The Brady Bunch."
Five hours later, guards were still scratching their heads.
Disgusted, the prisoner descended and requested a transfer
"to anywhere."
--------------------------
From: 282994@xavier.xu.edu (IMNMD2B)
A true story...
The other day in my Introductory Psychology course the class was
discussing Frued and his Theory of Consciousness. In Freud's theory,
there are basically three divisions of human awareness. The id is
instinct and desire for pleasure, the superego is conscience and
morality, and the ego is kind of like the self, or the part of an
individual which "blends" the id and the superego. The instructor
asked the class what kind of person would be characterized as having
an overdeveloped id, and someone correctly answered "a criminal, or a
child." Then she asked what kind of person might have an overdeveloped
superego. I said without thinking, "a Democrat?"
--------------------------
From: dant@techbook.techbook.com (Dan Tilque)
News item from the March 23 Portland Oregonian:
An unusual freeway shooting incident occured on I-205 where one driver
shot at another with a bow and arrow.
My comment: this must be part of the Oregon Trail 150th anniversary
celebration.
--------------------------
From: marc@urutu.sde.hp.com (Marc Sabatella)
Recently the fast food chain "Kentucky Fried Chicken" has been running
advertisements for their new buffet. In the television commercial, various
store personnel sing the praises of the buffet. They are not particularly good
singers, and the song is rather pathetic. The whole thing appears to have been
done in jest. This commercial is generally recognized (i.e., by a few of my
friends and I) as one of the dumbest in recent memory.
It seems that the local KFC franchise recognizes this as well. Yesterday the
sign outside the the store read (I am NOT making this up):
Try Our New Buffet
Or We'll Run The Commercial Again
--------------------------
From: freedman@CS.ColoState.EDU (keith freedman)
While performing some maintenance on the swap disk on a DecStation 3100, the
following error message came up:
ERROR: Not a Typewriter.
Seems to me that Dec has a clear grasp of the obvious.
--------------------------
From: jtisdel@digi.lonestar.org
The original form of this joke was releated to me by a co-worker, while
we were recently discussing the immediate Russian past.
A train was stalled on the Trans-Siberian Railway, on board were Tsar
Nicholas II, Lenin, Stalin, Khruschev, Breznhev, Chernynko, Andropov,
Gorbachev, and Yeltsin.
Tsar Nicholas stands up and says, "I shall make this train move." He gets
off the train, mounts his horse and rides off to Paris.
Lenin then stands up and says, "I shall make this train move." He leaves
the car and returns a few minutes later. "I've instituted a new 8 day work
week," he says and sits down. The train still doesn't move.
Stalin stands up and says, "I shall make this train move." He leaves the car
and returns a few minutes later. "I've shot the engineer," he says as he
sits down. The train still doesn't move.
Khruschev then stands up and says, "I shall make this train move." He leaves
the car and returns a few minutes later. "I've reinstated the engineer,
posthumously," he says as he sits down. The train doesn't move.
Breznhev then stands up and says, "I shall make this train move." He then
instructs everyone to act like the train is moving and sits down. The train
doesn't move.
Chernynko and Andropov both jointly declare "We shall make this train move."
They then get off the train. The train doesn't move.
Gorbachev, with a sigh, stands up and says "I shall make this train move." He
stands and, pulling down the window, yells outside "This train doesn't move!"
Gorbachev sits back down. The train doesn't move.
Yeltsin, quite put out, stands up and says "I shall change the train for one
that works!" He leaves and returns shortly with a new train. As the
passengers board it, they see that it is an old American Steam Engine which
is owned by the Germans and has no wheels. Is this train going to move?
--------------------------
From: ericj@u.washington.edu (Eric Johnson)
In Seattle, where seemingly everyone is an environmentalist, I saw the
following sign outside the fron of a Safeway grocery store:
"Sale! 100% RECYCLED Compost"
...and to think of the resources I've been wasting by buying the non-recycled
stuff :)
--------------------------
From: rpanoff@ncsa.uiuc.edu (Robert Panoff)
A notice on every table in a local Bratwurks restaurant declares:
"The reason our sausages are so good is that they are Made in Illinois.
The reason our beer is so good is that it is not Made in Illinois."
--------------------------
From: smorris@vorpal.ucsb.edu (Stephen Morris)
This is original.
Dateline, National Institutes of Health, Feb. 1999:
Human Genome Project scientists announced a significant breakthrough
in cracking the genetic code today. They disclosed that they have
solved the long-standing problem of why only a small fraction of the
DNA strand is actually used by the cell to code for proteins, while
the rest seems to be just unused "junk".
The crux of the discovery was the amino acid sequence:
ATGCATGGACTGATCTAGTCATGCTGACTGGTACATACCGAATCAGTACCATGGACATATACAGTAC
GTTACCGTGACCTCAGTCAATGGCCATCTCGTGACTTCGATCTACTGAAATCCATGATCATAGCATG
ATCAGTCCTACGTAGCATGCAATGCATGCATATAGCATATCACATTATACGACTACGTACATGACGT
ACCGTAGTACATCAGG
which was found to decode to:
"this space intentionally left blank."
--------------------------
From: Herb.Peyerl@novatel.cuc.ab.ca (Herb Peyerl)
Heard in passing down one of our corridors:
'I think I came up with a new marketing slogan for Microsoft'
"Windows/NT - From the people who brought you EDLIN".
--------------------------
From: mcconley@athena.mit.edu
[This is original.]
A friend of mine just informed me that you can now send e-mail to President
Clinton using the address president@whitehouse.gov. Of course, I was a little
skeptical, since, after all, does the President *really* have time to read all
those emails? Of course not; but nonetheless, it's real! But I still think
he can't read all those. More likely, he has some staff people reading them
over, and they send him a summary at the end of the day. Here's what a
typical encapsulation of the day's email might look like.
-------
Summary of Electronic Mail for President@WhiteHouse.Gov
June 2, 1993
Topic Number
------------
Bosnian conflict: 22,617
Support for Tax Policies: 198
Opposition to Tax Policies: 33,605
Harvard Professors with neato ideas: 288
Same with reasonable ideas: 9
Pro-Iraq: 5
Calls for Impeachment: 16,012
Travel agency ads: 61
Resumes for Cabinet openings: 4,125
Personal from Hollywood celebrities: 616
Barber called back to change appt: 1
Calls from Ross Perot: 33
Senators returning calls on budget: 0
Environmental (fwd to VP): 58,932
Foreign policy (fwd to VP): 23,811
Economy (fwd to VP): 3,096
Deficit (excl Perot, fwd to VP): 17
Health care (fwd to rodham@whitehouse): 1,456
Abortion (fwd to /dev/null): 99,361
Jokers sending harassing message after
learning of email account: 482,697
--------------------------
From: RSPAIN@macalstr.edu
This was my design for the Macalester Philosophy Club t-shirts. (on
the shirts, the questions are on front and the answers on back...)
The Top 10 Philosophy Questions of All Time, Answered!
10. How do I know anything really exists?
-Kick it *really* hard.
9. What is the essence of being human?
-Not understanding the opposite sex.
8. If a tree falls in the forest, and there's no one there to hear
it, does it make a sound?
-Not if it lands on a bunch of pillows.
7. How do I know I'm not just a brain in a vat, hooked up to a
computer simulation of life?
-Look in the mirror. If you see a gray, spongy thing in a
glass container, you are.
6. Can our minds exist seperately from our bodies?
-If they could, we'd just send our minds to class and sleep in
every morning.
5. Is there a God?
-A billion Hindus can't be wrong.
4. What is the nature of Knowledge?
-I'm still trying to figure out the nature of *college*.
3. What is the meaning of life?
-All evidence to date suggests it's chocolate.
2. Why get a Philosophy degree?
-It's more respectable than a theater degree, but you still get to
drink lots of espresso.
1. So, was Kant on drugs or what?
-Probably.
"Mac Philosophy: for the Metaphysically Challenged"
--------------------------
From: John_Karabaic@next.com (John Karabaic)
Went to my barbershop this morning. It's a lot like Floyd's shop on
the Andy Griffith Show, except it's called "Corky's". Since I don't
style my hair, I'm thankful to be able to pay $7 for just a haircut.
There was a sign in his window:
CLINTON CUTS
in shop: $7.00
on plane: $200.00
Well, Cincinnati *is* Republican Country.
--------------------------
From: tsa@cellar.org
Made this one up yesterday...
Knock Knock.
Who's There?
Recursion
Recursion who?
Knock Knock...
--------------------------
From: anthony_bacio@engtwomac.synoptics.com (Anthony Bacio)
"From the driver's seat, an overhead button lets the driver unlock and open the
sliding door, a feature that might appeal to someone dealing with a van load of
children."
--------------------------
From: wilson@blaze.cs.jhu.edu
I heard on the radio that the FBI now suspect that the letter
bombing at Yale is related to letter bombings in the late 70's.
My first thought was, "My, that's a sad commentary on the Post Office."
--------------------------
From: stanaway@comm.mot.com (Chris Stanaway)
Recently, United Airlines has started a new feature (in the U.S.
only), where on some flights you can listen in on the conversations
between the pilot and the tower through those nifty headphones they
give you. This also allows you to hear the other pilots that are
on the same frequency as your flight. Every statement is
acknowledged verbatim with the flight number identifying the
intended recieptant (i.e. "United 1301").
This actually happened recently on a flight leaving Chicago's
O'Hare Airport, while we were waiting in line on the runway.
Our flight was "United 1301".
Tower: United 1301, you are cleared for take off.
[angles, flight level and speed given].
[Pause, waiting for pilot to acknowledge]
Tower: United 1301, you there?
United 1301: Tower, United 1301. We're here, but we're
number 3 [in line].
Tower: Well who's number one?
Maybe they should reconsider allowing passengers to listen
in on conversations like this. :-)
--------------------------
From: kraitch@eecs.berkeley.edu (mark kraitchman)
]From the USENIX Association Newsletter ":login:" March/April 1993
Vol. 18, No. 2
An excerpt from the President's Letter "State of the Year 1992" by
Stephen C. Johnson, President [scj@usenix.org]
"On the business front, UNIX has been under attack from a variety of
sources, primarily by the nonexistant Windows NT. Luckily, the UNIX
vendors have their own nonexistant products with which to answer the
threat."
--------------------------
From: sjreeves@eng.auburn.edu (Stan Reeves)
Seen on a South Carolina road sign:
-------------------------
|[-- Clinton 6 |
| Prosperity 22 --] |
-------------------------
| |
| |
| |
--------------------------
From: owens@cookiemonster.cc.buffalo.edu (Bill Owens)
I was just skimming an article on X.400 in Open Systems Today magazine
(3/29/93, page 20) and came across a quote by Marshall Rose, well-known
expert on OSI:
"X.400 is nothing special technically. You can find more
cost-effective solutions for..."
(Continued on page 24)
Flipping the page, I read:
"...technology and communications at Wal-Mart."
Of course, there *was* another page of text in between, and Marshall's
quote actually finished with "...mail backbones". However, I suspect
the unintentional comment may be more correct...
--------------------------
From: frank@rover.bsd.uchicago.edu (FRANK BORGER)
Abstract of a recent phone conversation between myself and
a service person from our local communication department.
Me (after bouncing through about 6 offices)
"One of our computer lines, (xxx-yyyy) has a bad line. I can no longer
get an outgoing dial tone, and incoming calls get a message 'That
number is currently being tested, please try again later.' We've been
doing work-arounds, but wonder how long it will be down?"
Service-droid (after some delay talking to their computer...)
"Oh, that line was de-activated as a cost cutting measure. We can
re-activate it if you wish."
Me (somewhat puzzled at Ameritech's use of the English language...)
"You mean nobody was actually checking the line? Why did the recorded
message say the line was being tested?"
Service-droid, (rather bemused at questioning the voice of god...)
"Oh, that's always been the message you get when a line has been
de-activated."
--------------------------
From: pete@sst.icl.co.uk (Pete Bevin)
Our support department had a phone call recently from a user who had
received a new keyboard for his workstation, and found he couldn't log
in. So we got him to go in as root and change his password, and that
fixed the problem.
That afternoon, the user phoned back with the same problem. While we
were changing his password again, he added: ``By the way, my secretary
came along this afternoon and noticed the C and V keys were the wrong
way around, so she switched them around. Does that make a difference?''
--------------------------
--
Henry Cate III [cate3@netcom.com]
The Life collection maintainer, selections of humor from the internet
Opportunity is missed by most people because it is dressed in
overalls and looks like work. - Thomas Edison
Back to my Life Humor Page
Back to my humor page
Back to my home page